Warning: mkdir(): Permission denied in /home/virtual/lib/view_data.php on line 87 Warning: chmod() expects exactly 2 parameters, 3 given in /home/virtual/lib/view_data.php on line 88 Warning: fopen(/home/virtual/jikm/journal/upload/ip_log/ip_log_2026-04.txt): failed to open stream: No such file or directory in /home/virtual/lib/view_data.php on line 95 Warning: fwrite() expects parameter 1 to be resource, boolean given in /home/virtual/lib/view_data.php on line 96 COPD 동물모델에서 아교음 및 아교음가미의 폐손상 및 근감소 억제 효과

COPD 동물모델에서 아교음 및 아교음가미의 폐손상 및 근감소 억제 효과

Inhibitory Effects of Agyo-eum and Modified Agyo-eum on Lung Injury and Muscle Loss in a COPD Mouse Model

Article information

J Int Korean Med. 2025;46(6):1483-1504
Publication date (electronic) : 2025 December 30
doi : https://doi.org/10.22246/jikm.2025.46.6.1483
양원경1,2,, 우성천1,, 김승형2, 유이란3, 박양춘1,2
1 대전대학교 한의과대학 폐계내과학교실
1 Division of Respiratory Medicine, Dept. of Internal Medicine, College of Korean Medicine, Daejeon University
2 대전대학교 동서생명과학연구원
2 Institute of Bioscience and Integrative Medicine, Daejeon University
3 한국한의학연구원 한의과학연구부
3 KM Science Research Division, Korea Institute of Oriental Medicine
·Corresponding author: Yang-chun Park Korean Internal Medicine, Daejeon Korean Medicine Hospital of Daejeon University, 75, Daedeok-daero 176-beongil, Seo-gu, Daejeon, Republic of Korea TEL: 82-42-470-9126 FAX: 82-42-470-9486 E-mail: omdpyc@dju.kr
†These authors contributed equally to this work
Received 2025 November 27; Revised 2025 December 20; Accepted 2025 December 22.

Abstract

Objective:

This study aimed to evaluate the effects of Agyo-eum (AGE) and modified Agyo-eum (mAGE) on lung injury and muscle loss in a mouse model of chronic obstructive pulmonary disease (COPD).

Methods:

C57BL/6 mice were challenged with cigarette smoke extract (CSE) and lipopolysaccharide (LPS), and treated with AGE (250 mg/kg) or three concentrations of mAGE (125, 250, and 500 mg/kg). After euthanasia, bronchoalveolar lavage fluid (BALF) and lung tissue were analyzed using cytospin, enzyme-linked immunosorbent assay (ELISA), real-time polymerase chain reaction (PCR), flow cytometry, hematoxylin and eosin (H&E), and Masson’s trichrome staining. Grip strength was measured using a grip strength meter, and running time was measured using a treadmill. Quadriceps muscle tissue was stained with H&E and Masson’s trichrome.

Results:

AGE and mAGE significantly inhibited the increase in neutrophils in BALF. mAGE significantly decreased immune cell activity in BALF and lung tissue. It significantly inhibited increases in TNF-α, IL-17, MIP2, and CXCL-1 in BALF. Real-time PCR analysis showed that TNF-α, IL-17, CXCL-1, and TRPV1 mRNA expression in lung tissue significantly decreased compared with the control group. Histological analysis showed that lung tissue damage was significantly reduced. Grip strength and running time of COPD mice were significantly decreased compared with the control group. AGE and mAGE reduced damage on histological staining of muscle tissue.

Conclusion:

This study suggests the potential of AGE and mAGE as therapeutic agents for COPD by inhibiting lung injury and muscle loss.

Ⅰ. 서 론

만성폐쇄성폐질환(Chronic Obstructive Pulmonary Disease, COPD)은 비가역적인 기류 제한을 특징으로 하는 질병으로, 주로 흡연으로 인한 유해 입자 또는 가스에 대한 폐의 비정상적인 염증 반응과 관련되어 있다1. 전 세계적으로 COPD는 주요 사망 원인 중 하나이며, 매년 300만 명이 COPD로 인해 사망하고, 2060년에는 COPD로 인해 540만 명이 넘는 사망자가 발생할 것으로 예측되고 있다2. 또한 COPD로 인한 생산성 손실 및 막대한 의료비 지출은 환자뿐만 아니라 국가에게도 심각한 사회경제적 손실을 초래한다3-5. COPD 환자는 주로 호흡곤란, 기침, 가래 등의 호흡기 증상을 호소하며, 염증세포 활성화 및 산화적 스트레스를 통해 전신적인 염증 반응을 유발하여 다양한 동반질환이 발생한다.

COPD의 주요 동반질환으로는 폐고혈압, 폐암, 폐섬유증 등의 호흡기 질환, 심부전, 허혈성 심장질환 등의 심혈관계 질환, 위식도 역류 질환, 골다공증, 우울증 등이 포함된다6. 그 중 근육 감소 및 기능 장애는 COPD 환자의 예후 및 삶의 질에 중대한 영향을 미치는 임상적으로 중요한 동반질환이다. COPD 환자의 근감소는 단백질 대사 이상, 저산소증, 염증 및 산화적 스트레스, 영양 불량 등의 요인과 더불어 폐의 과다 팽창으로 인한 흉벽 리모델링 등의 복합적인 기전을 통해 발생한다. 이러한 근력 약화는 보행 장애 및 일상 활동의 제한으로 이어져 신체 활동량을 감소시키고, 이는 다시 근감소를 더욱 진행시켜 COPD를 악화시키는 악순환을 초래한다7-9. 따라서 COPD에 동반되는 근감소에 대한 치료 및 관리는 환자의 삶의 질 개선과 예후에 있어 매우 중요하다.

COPD에 대한 한약의 효과를 평가한 선행 연구들을 변증 분류10에 따라 살펴보면, 풍한형(風寒型)의 소청룡탕(小靑龍湯)11, 폐열형(肺熱型)의 과루행련환(瓜蔞杏連丸) 유래 GHX0212, 담탁형(痰濁型)의 사간탕(射干湯) 유래 SGX0113, 폐허형(肺虛型)의 감길탕(甘桔湯) 유래 GGX14, 신음허형(腎陰虛型)의 청상보하탕(淸上補下湯) 유래 PM01415 등에 대한 연구가 보고되었다. 특히 COPD 동물모델을 대상으로 인삼양영탕(人蔘養榮湯)16, 쌍화탕17, 황기의 Astragalus polysaccharide18의 근감소에 대한 치료 효과가 보고되었다.

아교음(阿膠飮)은 ≪성제총록(聖濟總錄)≫의 咳嗽門에 기재된 아교(阿膠)와 인삼(人蔘)으로 구성된 처방으로 오래된 기침에 사용한다고 기록되어 있다19. 아교는 항염증, 항산화, 항균, 조혈, 골다공증 억제 효과를 가진 약재로, COPD 동물모델 및 미세먼지로 유도된 폐손상 동물모델에서 폐의 염증 완화 및 폐기능 개선 효과가 보고되었다20,21. 인삼은 항염증, 항산화 효과와 더불어 호흡기 감염 관련 항바이러스 및 항균 효과가 보고되었다. 또한 근육의 산화적 손상을 완화하며, 유효 성분인 Ginsenoside는 COPD 동물모델에서 기관지 리모델링과 폐섬유화를 억제하였다22-24.

본 연구에서는 아교음과 아교음에 두충(杜沖)과 호도육(胡桃肉)을 가미한 아교음가미(阿膠飮加味)의 COPD로 인한 폐손상과 근감소에 대한 억제 효과를 실험적으로 확인하고자 하였다. 두충은 호중구의 pro-inflammatory cytokines 분비 및 단핵구와 대식세포 억제를 통한 항염증 효과와 더불어 influenza virus에 대한 항바이러스 효과가 보고되었으며25,26, 호도육은 항염증 cytokine인 adiponectin를 증가시키고 interleukin(IL)-1, IL-6을 감소시켜 산화적 스트레스 및 염증 반응을 억제하는 효과를 가진다27,28. COPD 및 이에 동반되는 근감소증의 병태생리가 만성 염증 및 산화 스트레스와 밀접하게 관련되어 있다는 점을 고려했을 때, 아교음 및 아교음가미가 COPD로 인한 폐손상 및 근감소에 대한 치료 효과를 나타낼 것으로 가설을 설정하였다. 이에 본 연구는 아교음 및 가미아교음이 COPD에 동반되는 폐손상과 근감소증에 미치는 효과를 종합적으로 평가하고자 하였다.

표준담배추출물(Cigarette Smoke Extract, CSE)과 Lipopolysaccharide(LPS)로 유발한 COPD 동물모델29을 이용하여 폐조직과 기관지폐포 세척액(Bronchoalveolar lavage fluid, BALF)에서 총 세포수를 측정하였고, 관련 cytokines를 enzyme-linked immunosorbent assay(ELISA)로 분석하였으며, 면역세포에 대한 영향을 fluorescence-activated cell sorting(FACS)으로, 연관 유전자의 발현 정도를 real-time polymerase chain reaction(RT-PCR)으로 측정하였다. 폐조직 손상 억제 작용은 폐 조직검사를 통해 평가하였으며, grip strength를 통해 근력을, treadmill을 이용하여 근지구력을 측정하였고, 근위축 억제 작용은 대퇴사두근 조직검사를 통해 평가하여 유의한 치료 효과를 확인하였다.

Ⅱ. 재료 및 방법

1. 재 료

1) 약 재

실험에 사용하기 위해 아교음(Agyo-eum, AGE) 및 아교음가미(modified Agyo-eum, mAGE)의 구성약물을 대전한약국(Daejoen, Korea)에서 구입하였으며 1첩의 구성과 용량은 Table 1 및 2와 같다. 아교음과 아교음가미 각각 500.0 g에 약재 중량의 10배에 해당하는 증류수를 넣고 환류 추출기(Heating Mantle Stirrer analog, EAMS 9502-06, Seoul, Korea)를 사용하여 100~120 ℃에서 2시간 동안 추출하였다. 추출 과정을 2회 실시하여 얻은 액을 여과한 다음, 감압 증류장치(rotary vacuum evaporator, Buchi B-480, Switzerland)로 농축하였고, 농축액을 동결 건조기(freezer dryer, Eyela FDU-540, Japan)로 완전히 건조하여 냉동(-84 ℃) 보관하면서 사용하였다. 최종적으로 아교음과 아교음가미는 초기 약재 500.0 g으로부터 각각 39.25 g과 35.5 g의 추출물을 얻어 7.85%와 7.1%의 수율을 나타냈다.

The Composition of Agyo-eum (AGE) and modified Agyo-eum (mAGE)

2) 시약 및 기기

실험에 사용한 시약으로 lipopolysaccharide(이하 LPS)는 Sigma사(USA) 제품을, mouse TNF-α(tumor necrosis factor-α), mouse IL-17(Interleukin-17), mouse MIP2(Macrophage inflammatory protein 2)는 R&D systems사(USA) 제품을 사용하였다. 그 밖에 FBS(Fetal Bovine Serum)는 Serum Source사 (USA) 제품을, formaldehyde, DMEM, RPMI-1640 배양액, D-PBS(Dulbecco’s phosphate buffered saline)는 Sigma사(USA) 제품을 사용하였고, 이외의 시약은 특급을 사용하였다.

기기는 열탕추출기(Daewoong, Korea), rotary vacuum evaporator(Buchi, Switzerland), freeze dryer (EYELA, Japan), CO2 incubator(Forma Scientific, USA), micro-pipet(Gilson, France), clean bench(Vision Scientific, Korea), autoclave(Sanyo, Japan), water bath (Vision scientific, Korea), Biosystem XA(Buxco Research System, USA), vortex mixer(Vision scientific, Korea), spectrophotometer(Shimazue, Japan), thermocycler system(MWG Biotech, Germany), deep-freezer(Sanyo, Japan), centrifuge(Sigma, USA), homogenizer(OMNI, USA), plate shaker(Lab-Line, USA), ELISA reader(Molecular Devices, USA), ice-maker(Vision scientific, Korea) 및 chemical balance(Cas, Korea) 등을 사용하였다.

2. 방 법

1) 동 물

실험에 사용한 동물은 수컷 7주령의 C57BL/6 계열 생쥐(오리엔트바이오, Korea)를 사용하였고, 고형 사료와 물을 제한을 두지 않고 섭취하도록 하였다. 사육 환경은 습도 50±10%와 온도 22~24 ℃를 유지하였고, 조명은 낮과 밤의 주기가 조절(12시간 주/야)이 되도록 하였으며, 실험 동물 몸무게의 평균은 24±4 g이었다. 대전대학교 동물실험윤리위원회에서 본 실험에 대하여 승인(승인번호: DJUARB2023-013)을 받은 다음 실험을 시행하였다.

2) Cigarette Smoke Extract(CSE)의 제조

(1) 표준담배 연소 및 연기 포집

표준담배로 사용된 Coresta Monitering Cigarette 7(Heinr. Borgwaldt, Germany)을 ISO3402 규정에 따라 온도 22±2 ℃ 및 상대습도 60±5%의 흡연공간에서 연소시켜 연기 포집을 실시하였다. 표준담배의 연소에는 자동흡연기(RM20/CS, Heinr. Borgwaldt, Germany)를 사용하였고, ISO3308 규정에 따랐다. 연소시간은 2.00±0.02초(기준: 꽁초 길이=tip paper 길이+3 mm)로 하였고, 흡연주기는 60±0.5초, 흡연 부피는 35.0±0.3 ml로 하였다. 연기 응축물의 포집은 92 mm 캠브리지 필터(Cambridge filter, ISO3308 규격품, USA)를 사용하였다.

(2) 표준담배 연기응축물의 추출

자동흡연기에서 표준담배 연기가 포집된 필터를 분리하여 100 ml 크기의 삼각플라스크에 넣고, isopropanol 50 ml을 첨가하여 잘 흔들어서 혼합한 다음, 8시간 이상 실온에 방치하여 추출하였다. 추출액을 여과한 다음 감압여과 농축기를 사용하여 농축한 후, 농축액을 Scintillation vial(03-340-25N, WHEATON, USA)에 담아 질소 가스를 이용하여 최종 농축하였다.

3) COPD 동물 모델 제작 및 약물 투여

7주령의 C57BL/6 계열 수컷 생쥐를 대상으로 표준담배 추출물(Cigarette smoke extract, CSE) 1 mg/ml와 LPS 100 μg/ml을 1:1로 혼합하여 1회 50 μl, 주 1회, 총 3주간 흡인시켜 COPD를 유발하였다. 먼저 7% Chloral hydrate(C8383, Sigma, USA)를 복강 주사하여 생쥐를 마취시킨 다음 CSE와 LPS의 혼합액을 기도로 투여하였다. 실험군은 유발을 위한 처리를 시행하지 않은 정상군(Normal, n=8), CSE와 LPS 혼합액을 투여한 대조군(Control, n=8), CSE와 LPS 혼합액을 투여하고 dexamethasone 3 mg/kg을 경구 투여한 양성대조군(Dexa, n=8), CSE와 LPS 혼합액을 투여하고 아교음 또는 아교음가미를 경구 투여한 실험군(AGE 250 mg/kg, mAGE 250, 500 mg/kg, 각각 n=8)으로 나누었다. 시험 약물의 투여는 2주 동안 매일 경구로 시행하였고, 실험 종료 후 12시간 이상 절식시킨 상태에서 희생한 다음, 각 실험군의 생쥐에서 기관지폐포세척액(Bronchoalveolar lavage fluid, BALF), 폐조직(lung tissue), 근조직(muscle tissue)을 분리하였다(Fig. 1).

Fig. 1

Time schedule of experimental design for CSE+LPS exposure mouse model.

CSE+LPS : intranasal injection of cigarette smoke extract 1 mg/ml and LPS 100 μg/ml.

4) 기관지폐포 세척액(BALF)의 분리

실험동물을 실험 최종일(28일 차)에 urethane으로 마취한 후 채혈하였다. 이어서 흉부를 열어 기도를 노출시킨 후, 기관(trachea)에 주사기를 삽입하여 끈으로 묶어 고정시킨 다음, 주사기의 피스톤을 전진, 후퇴시킴으로써 FBS를 함유하지 않은 DMEM 배지 1 ml를 폐(lung) 안으로 3회 순환시켜 기관지폐포 세척액(BALF)을 얻었다. BALF를 4 ℃, 1,750 rpm의 조건으로 5분간 원심분리 한 다음, 상층액은 cytokine 측정에 사용하기 위해 별도로 냉동보관하였다. BALF에서 분리한 세포는 ACK 용액으로 3분간 처리하여 적혈구를 용해시키고, FBS를 함유하지 않은 DMEM 배양액으로 세척한 다음, hemocytometer로 총 세포수를 측정하였다.

5) BALF 총 neutrophil 수 측정

BALF를 대상으로 cytospin을 통해 neutrophil 수를 측정하였다. 먼저 침전을 통해 혈구를 분리한 후, Diff-Quik staining을 3회 시행하고, PBS로 2회 세척한 다음, 400배율의 시야에서 광학현미경(Nikon, Japan)으로 측정하였다.

6) Enzyme-Linked Immunosorbent Assay(ELISA)

BALF 내 TNF-α, IL-17, MIP2의 발현량 측정을 위해 ELISA를 수행했다. Capture antibody를 coating buffer와 혼합하여 각 well에 100 μl씩 첨가하고, 4 ℃를 유지한 상태로 하룻밤 둔 다음, washing buffer로 4회에 걸쳐 세척하였다. 각각의 well에 assay diluent 200 μl씩을 넣고, 1시간 동안 실온에서 blocking을 한 다음, washing buffer로 4회에 걸쳐 세척하였다. 이어서 capture antibody가 코팅된 96 well plate에 standard 100 μl과 각 실험군의 혈청을 넣고 실온에서 2시간 동안 반응시켰다. 이후 washing buffer로 3회 세척한 뒤, 각 well에 biotin-conjugate antibody reagent 100 μl을 처리한 다음, 실온에서 1시간 동안 반응시켰다. 이후 washing buffer로 2회 세척한 후, streptavidin-HRP solution 100 μl을 각 well에 처리하여 1시간 동안 실온에서 반응시킨 후, washing buffer로 2회에 걸쳐 세척하였다. 이어 substrate solution 100 μl을 첨가하여 20분간 반응시킨 다음, stop solution 50 μl을 이용하여 반응을 종결시킨 후, 450 nm 파장에서 흡광도를 측정하였다.

7) Real-time Polymerase chain reaction(PCR) 분석

폐조직을 대상으로 TNF-α, IL-17, MIP2, TRPV1 mRNA의 발현 수준을 측정하기 위해 real-time PCR을 수행하였다. 적출한 생쥐의 폐조직에 RNAzol (CS-105B, Tel-Test, USA) 500 ml를 첨가한 뒤 용해될 때까지 분쇄하였다. 이후 혼합 부유액에 chloroform(CHCl3) 50 ml을 첨가하여 15초간 혼합한 다음, 얼음에 15분간 방치한 후, 13,000 rpm으로 원심분리하여 상층액 약 200 ml을 분리하였다. 이 상층액에 2-propranol 200 ml를 혼합하여 잘 흔들어준 뒤, 15분 동안 얼음에 방치한 다음, 13,000 rpm으로 원심분리하였다. 이어서 80% EtOH로 세척한 후, 3분 동안 vacuum pump(ULVAC, USA)로 건조시켜 RNA를 추출하였다. 추출한 RNA를 diethyl pyrocarbonate(DEPC, IBS-BW1004, Intron, Korea)로 처리된 증류수 20 ml에 녹인 다음, block heater(2050, Lab-Line, India)에서 75 ℃로 불활성화하여 first cDNA 합성에 사용하였다.

Total RNA 시료는 RNase-free 조건에서 처리되었으며, genomic DNA 오염 제거를 위한 DNase 처리 후 효소 불활성화 단계를 거쳐 역전사 반응의 주형으로 사용하였다. 역전사 반응은 dNTP, 환원제, 반응 buffer 및 M-MLV reverse transcriptase를 포함하는 표준 반응계를 이용하였으며, 제조사에서 권장하는 조건에 따라 first-strand cDNA를 합성하였다. 합성된 cDNA는 효소 불활성화 과정을 거쳐 이후의 real-time PCR 분석에 사용하였다.

Real-time PCR은 SYBR Green 기반의 상용 master mix와 전용 real-time PCR 장비를 이용하여 수행하였다. 표적 유전자의 발현 정량은 내재성 대조 유전자인 glyceraldehyde-3-phosphate dehydrogenase (G3PDH)를 기준으로 normalization하였으며, 표적 프라이머 및 probe 서열 정보는 Table 3에 제시하였다. 역전사 반응을 위해 2 μg의 total RNA와 DNase Ⅰ(10 U/ml) 2U/tube를 37 ℃의 heating block에서 30분 동안 반응시킨 후 75 ℃에서 10분간 변성시켰다. 이후 10 mM dNTP Mix(4026, 4027, 4028, 4029, TaKaRa, Japan) 2.5 ml 및 100 mM DTT(P1171, Promega, USA) 1 ml, 5x reaction buffer(M531A, Promega, USA) 4.5 ml를 첨가하고, M-MLV RT(M1705, Promega, USA) 1 ml를 추가한 다음, DEPC로 처리된 증류수를 더하여 최종 부피가 20 μl 되도록 조정하였다. 위의 반응 혼합액 20 μl를 2,000 rpm으로 5초간 원심 침강시키고, 37 ℃의 block heater에서 60분 동안 반응시켜서 first-strand cDNA를 합성시킨 후, 95 ℃에 5분간 방치하여 M-MLV RT를 불활성화시켜서 합성을 완료한 cDNA를 real-time PCR에 사용하였다. TaqMan 기반 반응 시스템을 적용하여 제조사 표준 프로토콜에 따라 증폭을 진행하였고, probe 농도 및 반응 조건 또한 해당 시스템에 적합하도록 구성하였다. 모든 실험은 동일한 조건 하에서 반복 수행하여 결과의 재현성과 신뢰성을 확보하였다. 합성한 cDNA는 Power SYBR Green PCR Master Mix(ABi, USA)와 Applied Biosystems 7500 Fast Real-Time PCR system(Applied Biosystems, USA)을 사용하여 실시간 PCR을 수행하였고, mouse glyceraldehyde-3-phosphate dehydrogenase(G3PDH) cDNA probe(Applied Biosystems, USA)를 대조군으로 사용했다. Probe의 primer 및 sequence는 Table 3에 제시하였으며, Taqman PCR Master mix를 반응액으로 사용하였고, probe의 최종농도가 200 nM이 되도록 반응시켰다. Real time quantitative PCR 조건에서 pre-denaturation은 50 ℃로 2분, 94 ℃로 10분, 40 cycles를 95 ℃로 15초, 60 ℃로 1분 수행하였다. 내부표준으로는 G3PDH를 사용하였다. Relative quantitative(RQ)는 target group의 Quantitative PCR y=x(1+e)n로 계산하였다(y=yield, x=starting quantity, e=efficiency, n=number of cycles).

Oligonucleotide Sequence Used for Real-time PCR

The Composition of modified Agyo-eum (mAGE)

8) BALF 내 면역세포 유세포 분석(flow cytometry analysis)

실험동물로부터 분리한 BALF 및 폐조직의 세포들을 5×105 개로 조정한 다음 4 ℃에서 면역 형광염색(immunofluorescence staining)을 실시하였다. 각각에 BD Pharmingen 사(San Diego, USA)의 PE-anti-CD4(553047), PE-anti-CD8(553033), FITC Rat anti-CD69(552879), FITC Rat anti-mouse CD21/CD35(553818), PE Rat Anti-mouse CD62L (553151), PE Rat Anti-mouse CD44(553135), PE-anti-Gr-1(553128) 및 PE-anti-Siglec-F(562068)을 넣고 얼음에서 30분간 반응시켰다. 이후 3회에 걸쳐 인산완충 생리식염수로 수세한 뒤, 세포의 분포 비율(%)을 flow cytometer의 Cell Quest 프로그램(BD Biosciences, San Diego, USA)을 이용하여 분석하고, 총세포수(total cells)를 기준으로 하여 절대 세포수(absolute number)를 산출하였다.

9) 폐조직의 Hematoxylin & Eosin과 Masson’s trichrome 염색

폐의 손상 정도를 평가하기 위해 H&E 염색과 M-T 염색을 시행하여 폐포(alveolar) 및 세기관지(bronchiole)의 형태와 혈액 세포의 침윤 정도를 확인하였다. 폐조직을 10% neutral buffered formalin에 24시간 고정시킨 다음, graded alcohol로 탈수시켰다. 이어서 파라핀에 포매하여 block을 제작한 후, microtome을 사용하여 4 μm 두께의 조직 절편을 제작하였다. 이후 H&E 염색을 위해 슬라이드를 1분 동안 hematoxylin에 담갔다가 흐르는 증류수에 여러 번 세척하고, 30초간 eosin에 담갔다가 다시 흐르는 증류수에 여러 번 세척하였다. 이어서 70%→95%→100%의 순서로 ethanol로 여러 번 세척하여 적절한 정도로 염색을 제거한 후 1분간 xylene에 담가 두었다. 이후 mounting medium xylene을 사용하여 cover-slide를 부착시킨 다음 광학현미경(Nikon, Japan)으로 200배율에서 관찰하였다. Masson’s trichrome 염색을 실시하기 위해 두께 4 μm의 절편을 만들고 탈 파라핀, 함수, 세척 과정을 거친 후, 56 ℃ Bouin 용액에서 1시간 동안 매염처리 후 세척한 다음, Weigert’s iron hematoxylin 용액으로 10분간 수세하였다. 이어서 Biebrich scarlet-acid fuchsin 용액으로 5분간 염색한 후 세척하고, phosphomolybdic phosphotungstic acid 용액을 이용하여 15분간 분별 염색한 다음, 5분간 aniline blue 용액에서 염색하였다. 다음으로 0.5% glacial acetic acid 용액에서 감별을 시행하고 탈수와 청명 과정을 거친 다음, cover-slide를 부착시켜 광학현미경(Nikon, Japan)으로 200배율에서 관찰하였다. 폐손상 정도를 평가하기 위한 조직학적 분석 점수 산출은 Tanaka 등26의 방법을 응용하여 폐포 및 세기관지 구조의 손상 정도, 콜라겐 침착 정도, 혈구세포 및 염증세포의 침윤 정도의 5개 항목을 3점 척도(0-2)로 평가하여 수행하였다.

10) Grip strength 측정

근력 평가를 위해 실험동물이 교차 그물망에 매달리는 시간을 측정하여 이를 통해서 사지의 근력을 평가하였다. 이때 실험동물의 원위부 근력을 검사하기 위하여 grip strength meter를 사용하였다. 설치류들은 후방에서 잡아당겨지면 버티기 위해 본능적으로 눈앞의 물체를 붙잡는 경향이 있다. 측정 장비는 mouse에게 힘 변환기(force transducer)가 연결된 막대기(bar)를 붙잡게 한 후 mouse의 꼬리를 후방으로 조심스럽게 잡아당기면, mouse가 버티지 못하고 막대기를 놓치게 되는 순간을 최대 악력으로 기록되도록 고안되었다. 먼저 실험자가 부드럽게 mouse의 몸통과 꼬리를 잡고 바닥보다 10 cm 위에 설치된 근력측정기의 막대기를 양쪽 앞발로 잡도록 유도한 후, 일정한 속도로 꼬리를 뒤로 잡아당겨서 mouse가 양쪽 앞발을 모두 놓을 때까지 수행함으로서 최대 악력을 측정하였다. 신뢰도를 높이기 위해 총 3회 반복 측정하여 최고값을 기록하여 사용하였고, 각 측정 간에는 20분의 충분한 휴식 시간을 두었다.

11) Treadmill 운동 시간 측정

지구성 능력은 에너지 전환능력, 호흡, 순환, 혈액을 통한 산소운반 능력이나 조직의 산소이용기능이 관여하고 있으며, 장시간 활동을 유지할 수 있는 전신의 지구력과 관련이 있다. 지구성 능력을 평가하기 위해 treadmill 검사를 수행하였고, mouse가 정지하는 행동을 3회 반복했을 시점까지의 시간을 측정하였다. 소형동물용 treadmill을 이용하여 초기 1분은 경사도 0%에서 6 m/min의 속도로 적응을 시킨 다음 15분간 8 m/min의 속도로 15분간 측정하였다. 신뢰도를 높이기 위해 총 3회 반복 측정하여 평균값을 기록하여 사용하였고, 각 측정 간에는 20분의 충분한 휴식 시간을 두었다.

12) 근육조직의 Hematoxylin & Eosin과 PTAH 염색

Mouse의 대퇴사두근에서 근육 샘플을 분리하고 이를 파라핀에 고정, 박리하여 절편을 제작하였다. 먼저 hematoxylin 용액에 5분, 증류수에 5분, eosin 용액에 30초 담근 후 건조하여 고정하였다. 또한 박리한 절편을 5분 동안 1% 과망간산 칼륨(potassium permangante) 수용액에 처리한 뒤, PBS로 3회 세척하고 24시간 동안 phosphotungstic acid hematoxylin (PTAH) 용액에서 처리한 다음 투명 봉입하였다. 각각의 절편을 광학현미경(Nikon, Japan)으로 100배율에서 관찰하였다.

13) 통계분석

각각의 실험으로부터 얻은 데이터는 mean±standard error of mean(SEM)으로 기록하였고, 그룹 간 비교는 SPSS software(ver. 12.0, SPSS Inc., USA)를 사용하여 독립표본 T검정으로 분석하였다. 통계적 유의성은 P value가 0.05보다 작은 경우를 기준으로 하였고, 다시 0.05, 0.01 및 0.001보다 작은 경우로 구분하였다.

Ⅲ. 결 과

1. BALF 내 neutrophil 증가에 미치는 영향

COPD가 유발된 동물의 BALF에서 neutrophil을 측정한 결과 대조군은 78.33±7.89개로 나타나 정상군의 1.50±0.76개보다 유의한 증가를 보였으며, dexamethasone을 처리한 양성대조군은 34.30±7.45개, AGE 250 mg/kg을 투여한 실험군은 38.33±8.70개, mAGE 250과 500 mg/kg을 투여한 실험군은 각각 27.67±8.83개, 17.00±6.36개로 나타나 대조군에 비하여 유의하게 감소하였다(Fig. 2).

Fig. 2

Effect of AGE and mAGE on (A) cytospin image of neutrophils and (B) absolute number of neutrophils in BALF of COPD mice.

Mice were injected intranasally with CSE+LPS (Control), and then treated with Dexa (dexamethasone 3 mg/kg) and SHT (250, 500 mg/kg) for 28 days (n=4). All values are mean±standard error. † : Significantly different from the Normal (††† p<0.001), * : Significantly different from the Control (** p<0.01, *** p<0.001).

2. BALF 및 폐조직 내 면역세포 활성에 미치는 영향

COPD를 발생시킨 동물모델에서 BALF의 면역세포 활성에 대하여 FACS 분석을 시행한 결과, neutrophil, CD4+/CD69+ 세포는 mAGE 모든 농도에서 대조군보다 유의성 있게 감소하였고, CD4+, CD62L-/CD44high+ 세포는 mAGE 500 mg/kg 투여군에서 대조군보다 유의성 있게 감소하였으며, Gr-1+/siglecF- 세포는 AGE 250 mg/kg과 mAGE의 모든 농도에서 대조군보다 유의성 있게 감소하였다(Table 4).

Absolute Number of Various Immune Cells in BALF of COPD Mouse Model treated by AGE and mAGE

폐조직의 면역세포 활성에 대하여 FACS 분석을 시행한 결과, neutrophil, CD62L-/CD44high+, CD21+/B220- 세포는 mAGE 250과 500 mg/kg 투여군에서 대조군보다 유의성 있게 감소하였고, lymphocyte, CD8+/CD69+ 세포는 mAGE 250 mg/kg 투여군에서 대조군보다 유의성 있게 감소하였으며, CD4+/CD69+ 세포는 AGE 250 mg/kg, mAGE 250, 500 mg/kg 투여군에서 대조군보다 유의성 있게 감소하였고, Gr-1+/siglecF- 세포는 AGE 250 mg/kg과 mAGE의 모든 농도에서 대조군보다 유의성 있게 감소하였다(Table 5).

Absolute Number of Various Immune Cells in Lung of COPD Mouse Model treated by AGE and mAGE

3. BALF 내 cytokines 생성에 미치는 영향

1) TNF-α 생성에 미치는 영향

COPD가 유발된 대조군의 TNF-α는 483.18±13.59 pg/ml로 나타나 정상군의 251.90±14.02 pg/ml보다 유의하게 증가하였고, dexamethasone을 처리한 양성대조군은 256.75±11.84 pg/ml, AGE 250 mg/kg을 투여한 실험군에서는 349.29±9.53 pg/ml, mAGE 125, 250, 500 mg/kg을 투여한 실험군에서는 389.73±26.74, 333.38±26.28, 335.68±12.69 pg/ml로 나타나 모든 농도에서 대조군에 비하여 유의하게 감소하였다(Fig. 3).

Fig. 3

Effect of AGE and mAGE on TNF-α production in BALF of COPD mice.

Mice were injected intranasally with CSE+LPS (Control), and then treated with Dexa (dexamethasone 3 mg/kg), AGE250 (250 mg/kg) and mAGE125 (125, 250, 500 mg/kg) for 28 days (n=4). Level of TNF-α was determined using ELISA. All values are mean±standard error. † : Significantly different from the Normal (††† p<0.001), * : Significantly different from the Control (*** p<0.05), ** : Significantly different from the Control (*** p<0.01). *** : Significantly different from the Control (*** p<0.001).

2) IL-17 생성에 미치는 영향

COPD가 유발된 대조군의 IL-17는 93.35±2.46 pg/ml로 나타나 정상군의 39.08±1.85 pg/ml보다 유의하게 증가하였으며, COPD를 유발하여 dexamethasone을 처리한 양성대조군은 45.14±1.62 pg/ml, AGE 250 mg/kg을 투여한 실험군에서는 50.87±5.05 pg/ml, mAGE 125, 250, 500 mg/kg을 투여한 실험군에서는 94.06±23.20, 59.10±4.69, 65.60±6.28 pg/ml로 나타나 AGE 250 mg/kg, mAGE 250, 500 mg/kg을 투여한 실험군에서 대조군에 비교하여 유의하게 감소하였다(Fig. 4).

Fig. 4

Effect of AGE and mAGE on IL-17 production in BALF of COPD mice.

Mice were injected intranasally with CSE+LPS (Control), and then treated with Dexa (dexamethasone 3 mg/kg), AGE250 (250 mg/kg) and mAGE125 (125, 250, 500 mg/kg) for 28 days (n=4). Level of IL-17 was determined using ELISA. All values are mean±standard error. † : Significantly different from the Normal (††† p<0.001), * : Significantly different from the Control (** p<0.05, ** p<0.01, *** p<0.001).

3) MIP2 생성에 미치는 영향

COPD가 유발된 대조군의 MIP2는 175.08±1.89 pg/ml로 나타나 정상군의 109.55±2.21 pg/ml보다 유의하게 증가하였으며, COPD를 유발하여 dexamethasone을 처리한 양성대조군은 125.46±7.52 pg/ml, AGE 250 mg/kg을 투여한 실험군에서는 122.11±5.23 pg/ml, mAGE 125, 250, 500 mg/kg을 투여한 실험군에서는 182.08±4.67, 129.52±4.11, 130.44±3.60 pg/ml로 나타나 AGE 250 mg/kg, mAGE 250, 500 mg/kg을 투여한 실험군에서 대조군에 비교하여 유의하게 감소하였다(Fig. 5).

Fig. 5

Effect of AGE and mAGE on MIP2 production in BALF of COPD mice.

Mice were injected intranasally with CSE+LPS (Control), and then treated with Dexa (dexamethasone 3 mg/kg), AGE250 (250 mg/kg) and mAGE125 (125, 250, 500 mg/kg) for 28 days (n=4). Level of MIP2 was determined using ELISA. All values are mean±standard error. † : Significantly different from the Normal (††† p<0.001), * : Significantly different from the Control (* p<0.05, ** p<0.01, *** p<0.001).

4) CXCL-1 생성에 미치는 영향

COPD가 유발된 대조군의 CXCL-1은 204.60±15.34 pg/ml로 나타나 정상군의 122.08±23.61 pg/ml보다 유의하게 증가하였으며, COPD를 유발하여 dexamethasone을 처리한 양성대조군은 121.80±7.66 pg/ml, AGE 250 mg/kg을 투여한 실험군에서는 166.23±12.23 pg/ml, mAGE 125, 250, 500 mg/kg을 투여한 실험군에서는 160.96±8.33, 157.20±12.44, 137.13±23.72 pg/ml로 나타나 mAGE 125, 250, 500 mg/kg을 투여한 실험군에서 대조군에 비교하여 유의하게 감소하였다(Fig. 6).

Fig. 6

Effect of AGE and mAGE on CXCL-1 production in BALF of COPD mice.

Mice were injected intranasally with CSE+LPS (Control), and then treated with Dexa (dexamethasone 3 mg/kg), AGE250 (250 mg/kg) and mAGE125 (125, 250, 500 mg/kg) for 28 days (n=4). Level of CXCL-1 was determined using ELISA. All values are mean±standard error. † : Significantly different from the Normal (††† p<0.001), * : Significantly different from the Control (* p<0.05, ** p<0.01, *** p<0.001).

4. 폐조직 내 cytokine mRNA 발현에 미치는 영향

1) TNF-α mRNA 발현에 미치는 영향

COPD가 유발된 대조군의 TNF-α mRNA Relative Quantitive(RQ)는 2.92±0.60으로 나타나 정상군의 0.81±0.21보다 증가하였으며, COPD를 유발한 다음 dexamethasone을 처리한 양성대조군은 1.03±0.32, AGE 250 mg/kg을 투여한 실험군에서는 0.62±0.29, mAGE 125, 250, 500 mg/kg을 투여한 실험군에서는 1.41±0.61, 2.12±1.11, 2.13±0.92로 나타나 AGE 250 mg/kg을 투여한 실험군에서 대조군에 비교하여 유의하게 감소하였다(Fig. 7).

Fig. 7

Effect of AGE and mAGE on TNF-α mRNA expression in lung tissue of COPD mice.

Mice were injected intranasally with CSE+LPS (Control), and then treated with Dexa (dexamethasone 3 mg/kg), AGE250 (250 mg/kg) and mAGE125 (125, 250, 500 mg/kg) for 28 days (n=4). All values are mean±standard error. † : Significantly different from the Normal (††† p<0.001), * : Significantly different from the Control (* p<0.05, ** p<0.01, *** p<0.001).

2) IL-17 mRNA 발현에 미치는 영향

대조군의 IL-17 mRNA Relative Quantitive(RQ)는 22.80±0.95로 나타나 정상군의 4.51±0.95보다 증가하였으며, COPD를 유발한 다음 dexamethasone을 처리한 양성대조군은 7.57±1.82, AGE 250 mg/kg을 투여한 실험군에서는 6.74±2.80, mAGE 125, 250, 500 mg/kg을 투여한 실험군에서는 8.74±2.88, 10.05±3.02, 12.66±3.79로 나타나 AGE 250 mg/kg을 투여한 실험군에서 대조군에 비교하여 유의하게 감소하였다(Fig. 8).

Fig. 8

Effect of AGE and mAGE on IL-17 mRNA expression in lung tissue of COPD mice.

Mice were injected intranasally with CSE+LPS (Control), and then treated with Dexa (dexamethasone 3 mg/kg), AGE250 (250 mg/kg) and mAGE125 (125, 250, 500 mg/kg) for 28 days (n=4). All values are mean±standard error. † : Significantly different from the Normal (††† p<0.001), * : Significantly different from the Control (* p<0.05, ** p<0.01, *** p<0.001).

3) CXCL-1 mRNA 발현에 미치는 영향

대조군의 CXCL-1 mRNA Relative Quantitive (RQ)는 5.43±2.20으로 나타나 정상군의 0.75±0.24보다 증가하였으며, COPD를 유발한 다음 dexamethasone을 처리한 양성대조군은 0.76±0.21, AGE 250 mg/kg을 투여한 실험군에서는 0.69±0.22, mAGE 125, 250, 500 mg/kg을 투여한 실험군에서는 0.83±0.28, 0.52±0.18, 1.00±0.28로 나타나 AGE 250 mg/kg, mAGE 125, 250, 500 mg/kg을 투여한 모든 실험군에서 대조군에 비교하여 유의하게 감소하였다(Fig. 9).

Fig. 9

Effect of AGE and mAGE on CXCL-1 mRNA expression in lung tissue of COPD mice.

Mice were injected intranasally with CSE+LPS (Control), and then treated with Dexa (dexamethasone 3 mg/kg), AGE250 (250 mg/kg) and mAGE125 (125, 250, 500 mg/kg) for 28 days (n=4). All values are mean±standard error. † : Significantly different from the Normal (††† p<0.001), * : Significantly different from the Control (* p<0.05, ** p<0.01, *** p<0.001).

4) TRPV1 mRNA 발현에 미치는 영향

대조군의 MIP2 mRNA Relative Quantitive (RQ)는 5.71±1.82로 나타나 정상군의 0.64±0.30보다 증가하였으며, COPD를 유발한 다음 dexamethasone을 처리한 양성대조군은 1.19±0.71, AGE 250 mg/kg을 투여한 실험군에서는 0.90±0.40, mAGE 125, 250, 500 mg/kg을 투여한 실험군에서는 1.72±0.74, 2.44±1.20, 3.69±2.25로 나타나 AGE 250 mg/kg와 mAGE 125 mg/kg을 투여한 실험군에서 대조군에 비교하여 유의하게 감소하였다(Fig. 10).

Fig. 10

Effect of AGE and mAGE on TRPV1 mRNA expression in lung tissue of COPD mice.

Mice were injected intranasally with CSE+LPS (Control), and then treated with Dexa (dexamethasone 3 mg/kg), AGE250 (250 mg/kg) and mAGE125 (125, 250, 500 mg/kg) for 28 days (n=4). All values are mean±standard error. † : Significantly different from the Normal (††† p<0.001), * : Significantly different from the Control (* p<0.05, ** p<0.01, *** p<0.001).

5. 폐조직 손상의 조직학적 변화에 미치는 영향

정상군의 폐조직에서는 크기가 일정하고 균일한 형태의 폐포가 관찰되었으나, COPD가 유발된 대조군에서는 폐포의 크기와 형태가 일정하지 않으면서 기도벽의 비후가 보이고, 폐포 주변으로 증가된 세포 침착이 관찰되었다. Dexamethasone을 처리한 양성대조군에서는 비교적 균일하게 폐포의 형태가 유지되었고, AGE과 mAGE를 투여한 실험군에서는 증가된 세포 침착이 폐포 주변에서 관찰되었으나 대조군에 비해 상대적으로 폐포 형태가 비교적 균일하게 유지되는 것이 관찰되었으며 고농도에서 더욱 현저하였다(Fig. 11A). 폐조직의 손상 정도를 점수화하여 정량적으로 평가한 결과, 대조군은 10.00±0.00으로 측정되어 정상군의 2.00±0.00보다 유의하게 증가하였으며, 양성대조군은 3.50±0.50으로 유의성 있게 감소하였다. AGE 250 mg/kg을 투여한 실험군에서는 6.00±1.00, mAGE 125, 250, 500 mg/kg을 투여한 실험군에서는 9.00±0.00, 6.00±0.00, 4.50±0.00로 나타나 AGE 250 mg/kg, mAGE 125, 250, 500 mg/kg을 투여한 실험군에서 대조군에 비교하여 유의하게 감소하였다(Fig. 11B).

Fig. 11

Effect of AGE and mAGE on histophathological changes in the lung of CSE+LPS-induced COPD mice.

Mice were injected intranasally with CSE+LPS (Control), and then treated with Dexa (dexamethasone 3 mg/kg), AGE250 (250 mg/kg) and mAGE125 (125, 250, 500 mg/kg) for 28 days (n=4). A) Representative sections of lung stained with H&E stain and M-T stain. Image from light microscope at 100× magnification. (B) Quantitative evaluation of the degree of lung tissue damage in the sections. All values are mean±standard error. †: Significantly different from the Normal (††† p<0.001), * : Significantly different from the Control (* p<0.05, ** p<0.01, *** p<0.001).

6. Grip strength에 미치는 영향

대조군의 grip force(gf)는 111.49±4.55로 나타나 정상군의 130.84±3.86보다 감소하였으며, COPD를 유발한 다음 dexamethasone을 처리한 양성대조군은 111.39±5.54, AGE 250 mg/kg을 투여한 실험군에서는 140.89±2.12, mAGE 125, 250, 500 mg/kg을 투여한 실험군에서는 132.13±1.90, 140.46±2.57, 136.74±2.17로 나타나 AGE 250 mg/kg, mAGE 125, 250, 500 mg/kg을 투여한 모든 실험군에서 대조군에 비교하여 유의하게 증가하였다(Fig. 12).

Fig. 12

Effect of AGE and mAGE on grip strength of COPD mice.

Mice were injected intranasally with CSE+LPS (Control), and then treated with Dexa (dexamethasone 3 mg/kg), AGE250 (250 mg/kg) and mAGE125 (125, 250, 500 mg/kg) for 28 days (n=4). Grip force was determined using grip strength meter. All values are mean±standard error. † : Significantly different from the Normal (††† p<0.001), * : Significantly different from the Control (* p<0.05, ** p<0.01, *** p<0.001).

7. Treadmill 운동 시간에 미치는 영향

대조군의 running time(min)은 1.60±0.06으로 나타나 정상군의 12.69±0.99보다 감소하였으며, COPD를 유발한 다음 dexamethasone을 처리한 양성대조군은 3.67±0.50, AGE 250 mg/kg을 투여한 실험군에서는 5.01±1.34, mAGE 125, 250, 500 mg/kg을 투여한 실험군에서는 3.69±0.46, 6.13±1.77, 8.54±1.83으로 나타나 AGE 250 mg/kg, mAGE 125, 250, 500 mg/kg을 투여한 모든 실험군에서 대조군에 비교하여 유의하게 감소하였다 증가하였다(Fig. 13).

Fig. 13

Effect of AGE and mAGE on running time of COPD mice.

Mice were injected intranasally with CSE+LPS (Control), and then treated with Dexa (dexamethasone 3 mg/kg), AGE250 (250 mg/kg) and mAGE125 (125, 250, 500 mg/kg) for 28 days (n=4). Grip force was determined using grip strength meter. All values are mean±standard error. † : Significantly different from the Normal (††† p<0.001), * : Significantly different from the Control (* p<0.05, ** p<0.01, *** p<0.001).

8. 근육 손상의 조직학적 변화에 미치는 영향

근조직의 손상을 평가하기 위해 H&E 및 PTAH 염색을 실시한 결과, 정상군에서는 건을 형성하고 있는 건 섬유들이 치밀하게 차 있었으며 콜라겐 섬유들의 결을 따라 섬유모세포들이 질서 정연하게 배열되어 있는 것이 관찰되었다. COPD가 유발된 대조군에서는 건을 구성하는 건 섬유들의 소실이 나타나 섬유의 밀도가 감소하였으며, 섬유모세포들의 수적 감소가 나타났다. 또한 섬유모세포들의 배열도 정상군에 비해 불규칙성이 증가하였으며, 군데군데 모여 있는 것이 관찰되었다. AGE 250 mg/kg 및 mAGE 250, 500 mg/kg을 투여한 실험군에서는 건 섬유의 밀도가 일부 감소하였으나 짧으면서 끝이 뾰족한 모양(small and stick-like shape)을 한 다수의 섬유모세포들이 비교적 규칙적으로 배열되어 있는 것이 관찰되었다(Fig. 14).

Fig. 14

Effect of AGE and mAGE on histophathological changes in the quadriceps muscle of CSE+LPS-induced COPD mice model.

Mice were injected intranasally with CSE+LPS (Control), and then treated with Dexa (dexamethasone 3 mg/kg), AGE250 (250 mg/kg) and mAGE125 (125, 250, 500 mg/kg) for 28 days (n=4). Grip force was determined using grip strength meter. All values are mean±standard error. Representative sections of quadriceps muscle stained with H&E stain and M-T stain. Image from light microscope at 100× magnification.

Ⅳ. 고 찰

COPD는 기도와 폐실질의 만성적인 염증 반응이 특징인 질환으로, 국소적인 염증뿐만 아니라 전신적인 염증 반응으로 구조적 변화를 일으킨다. 폐실질에서 증가된 대식세포, 중성구, 림프구가 chemotactic factor로 작용하는 염증 매개체를 분비하여 염증 반응을 증폭시키고, 단백분해효소 분비를 통해 결합조직을 구성하는 elastin을 파괴하여 폐기종을 발생시킨다30,31. 소기도에서는 만성 염증을 통한 반복적인 기도벽의 손상이 성장인자의 과분비를 유발하여 기관지 평활근의 비대와 섬유화를 일으키고, 이는 기도의 구조를 변형시킨다32. 이러한 염증 반응과 구조적 변화는 기류 제한과 폐의 과팽창을 발생시켜 호흡곤란 및 운동 기능 저하로 이어진다33.

근감소증(Sarcopenia)은 근육량과 근력의 감소를 특징으로 하는 질환으로, 전 세계적인 고령화 추세에 따라 유병률이 증가하고 있으며 운동 및 일상생활 능력 저하, 낙상 등의 여러 문제를 야기한다34. 근감소증은 COPD 환자의 주요 동반질환으로서 연령, COPD의 중증도, 기류 제한의 정도에 따라 증가하는 경향을 보인다35. COPD에 동반되는 근감소증은 호흡곤란으로 인한 신체 활동량의 감소, 염증성 cytokines이 매개하는 전신 염증 반응, 산화 스트레스로 인한 근육 손상, 영양 불균형, 저산소증 등의 복합적인 기전을 통해 발생하는 것으로 여겨진다. COPD 환자의 하지 골격근은 근력과 근지구력이 약화되고 근섬유 변화 및 모세혈관 밀도 감소 등의 구조적 변화가 발생한다. 또한 횡격막을 포함한 호흡근은 만성적인 과부하 상태가 되어 근섬유의 수축력이 감소하는 양상을 보인다36. 근감소증이 진행되면 환자의 신체 활동 및 호흡 기능이 더욱 저하되어 증상이 악화되고, 이는 다시 근육의 감소를 악화시키는 악순환이 반복된다. 따라서 COPD 환자 치료에 있어 근감소증에 대한 처치가 필수적으로 고려되어야 한다. COPD에 동반된 근감소증의 치료법으로는 호흡재활, 적절한 영양 섭취, anabolic steroids 등을 고려할 수 있다7. 그러나 중증도가 심한 환자의 경우 호흡재활과 같은 운동 치료를 지속하기 어려우며 전신 염증 상태 지속과 이화 작용 증가로 인해 근육량의 회복이 어렵다는 제한점이 존재한다. 이에 COPD에 동반된 근감소증에 대한 새로운 치료법이 필요한 실정으로, 본 연구에서는 아교음과 아교음가미의 COPD에 동반되는 폐손상과 근감소증에 대한 효과를 평가하고자 하였다.

먼저 COPD 동물모델에서 분리한 BALF에서 neutrophil의 증감을 cytospin으로 분석한 결과, 대조군에서는 neutrophil이 유의하게 증가하였고 아교음과 가미아교음을 투여한 실험군에서는 유의한 감소를 보였다. Neutrophil의 증가는 COPD 환자에서 기류제한을 포함한 폐기능 감소의 진행을 촉진시키고37, 급성악화가 발생할 때 기도염증을 증가시키는 역할을 하는 것으로 알려져 있다38. 따라서 아교음과 가미아교음은 COPD의 병리기전에서 주요한 역할을 담당하는 neutrophil의 증가를 감소시킴으로써 COPD의 진행과 기도염증을 억제하는데 작용할 수 있을 것으로 생각된다.

다음으로 BALF와 폐조직에서 면역세포의 발현 양상을 FACS를 통해 분석한 결과, 아교음과 가미아교음 투여가 lymphocyte, neutrophil, CD4+, CD4+CD69+, CD8+CD69+, CD62L-CD44high+, CD21+B220+, Gr-1+SiglecF-와 같은 면역세포 아형의 발현을 억제하였다. 만성 흡연은 기도 내 CD4+ 조절 T세포를 증가시키고 CD4+CD69+ 세포는 활성화된 CD4+ T세포를 반영한다39. 활성화된 CD4+ T 세포는 주로 Th1(T helper 1) 유형으로 나타나며, 인터페론 감마(IFN-γ)와 같은 염증성 사이토카인을 분비하여 대식세포와 호중구 같은 다른 염증 세포를 활성화하고, 폐 조직 파괴(폐기종)를 유발 및 유지하는 데 기여한다40. 또한 CD4+ T 세포가 활성화되면 CD44high와 CD62L-이 나타나는데 COPD에서 혈중 neutrophil은 하향 조절된 CD62L의 발현으로 표현형을 확인할 수 있고41, CD44는 lymphocyte가 염증 부위로 이동하는 과정에 필수적 역할을 한다42. Gr-1은 mouse의 neutrophil 및 일부 단핵구/대식세포에서 발현되는 표면 마커로 Gr-1+SiglecF- 표현형은 neutrophil 집단을 반영하며 SiglecF- neutrophil의 발달을 억제하면 폐기종 증상의 완화할 수 있을 것으로 기대한다43. 아교음과 가미아교음이 BALF와 폐조직에서 면역세포들의 발현을 억제하는 것은 아교음과 가미아교음이 COPD의 면역세포 매개 병리적 면역반응에 대해 작용할 수 있음을 나타낸다.

COPD를 유도한 동물모델의 BALF를 수집하여 ELISA 및 PCR 검사를 시행한 결과, 정상군과 비교하여 대조군의 TNF-α 및 IL-17은 유의하게 증가하였으며, 아교음과 가미아교음을 투여한 실험군에서는 대조군과 비교하여 유의하게 감소하였다. TNF-α는 COPD 환자의 객담에서 증가를 보이고44, 악액질과 골격근 손실을 동반한 중증 COPD 환자의 혈청에서도 증가된 모습을 보인다45. IL-17는 neutrophil의 생존 기간 연장46과 neutrophil의 장기 흡연자 말초기도 축적에 관여한다47. 따라서 아교음과 가미아교음은 이러한 관련 염증 cytokine들을 조절함으로써 COPD에서 neutrophil이 매개된 염증을 제한하는 효과를 나타내는 것으로 사료된다. 또한MIP2와 CXCL-1은 주로 macrophage로부터 분비되는 chemokine으로서 neutrophil을 포함한 염증 및 면역세포가 특정 부위로 모이도록 유도하는 것으로 알려져 있어48 아교음과 가미아교음이 MIP2의 발현을 감소시키는 결과는 두 약물이 기도로 염증세포가 이동하는 것에 대한 억제 작용을 할 가능성을 시사한다. 아교음과 가미아교음 투여는 TRPV1의 발현을 억제하는 결과를 보였는데 TRPV1 증가는 감각 구심신경의 말단에서 기침반사의 민감성을 증가시키는데 캡사이신, 온도, 산(acid), bradykinin, archidonic-acid derivatives 등 다양한 염증성 매개물질에 의해 활성화된다49. 아교음과 가미아교음은 TRPV1의 발현을 억제함으로써 COPD의 주요 증상 중의 하나인 기침을 억제하는 작용을 나타낼 수 있을 것으로 생각된다.

COPD 동물모델의 폐조직에 대한 H&E staining 및 M-T staining을 통한 조직학적 분석에서 정상군의 폐포들은 작고 일정한 크기로 균일한 형태를 유지하는 것으로 관찰되었으나, 대조군에서는 다수의 확장된 폐포들이 관찰되어 균일한 형태를 유지하지 못하였으며, 기도벽의 비후, 콜라겐 침착 및 다수의 염증세포들이 소기도 주변에 침윤된 것이 관찰되었다. 이러한 변화는 COPD의 병태생리에서 집중적으로 기류제한이 발생하는 위치인 2 mm 이하 소기도에서 폐포의 비정상적인 영구적 확장과 기도벽의 섬유화 등의 비가역적인 내경 감소가 발생하는 것을 반영한다50. 아교음과 가미아교음을 투여한 실험군에서는 폐포의 형태와 크기가 비교적 균일하게 유지되고, 염증세포의 침윤이 감소된 것을 관찰할 수 있었으며, 정량적으로 분석한 조직학적 손상 정도가 아교음 및 가미아교음 투여로 유의하게 감소되는 것으로 나타나 아교음과 가미아교음이 폐조직이 손상되는 것을 방어할 수 있음이 확인되었다.

COPD를 유도한 동물모델에서 근력 변화에 대한 아교음과 가미아교음의 효능을 파악하기 위하여 실험동물을 교차 그물망에 매달리도록 하고 후방으로 천천히 당겨서 grip strength를 측정한 결과, 대조군에서 정상군에 비하여 유의하게 감소하여 근력 악화를 확인하였고, 아교음과 가미아교음을 투여한 실험군에서는 유의하게 증가하는 것으로 나타났다. COPD 환자에서 동반되는 사지 근육의 위축과 약화는 신체 활동 참여의 어려움, 운동 불내성(exercise intolerance), 삶의 질 저하, 조기 사망 등 질병의 예후에 중요한 결과를 초래한다51. 따라서 위와 같은 결과는 아교음과 가미아교음이 COPD에서 발생하는 근력 감소를 완화하는 작용을 나타낼 수 있음을 시사한다.

COPD를 유도한 동물모델에서 신체수행능력에 대한 아교음과 가미아교음의 효능을 평가하기 위하여 treadmill을 이용하여 running time을 측정한 결과, 대조군에서 정상군에 비하여 유의하게 감소하여 신체수행능력의 감소를 확인하였고, 아교음과 가미아교음을 투여한 실험군에서는 유의하게 증가하는 것으로 나타났다. COPD 환자는 활동시 발생하는 호흡곤란으로 활동량이 줄어들게 되고, 이로 인하여 근력이 약화되며, 운동능력이 다시 감소하게 되어 숨이 더욱 차는 악순환을 보인다52. 아교음과 가미아교음은 COPD 환자의 운동능력 감소를 완화하여 호흡곤란으로 인한 활동 저하를 줄이는 효과를 나타낼 수 있을 것으로 생각된다.

COPD 동물모델의 대퇴사두근 근육샘플에 대한 H&E 및 PTAH 염색을 통한 조직학적 분석에서 정상군은 건을 형성하고 있는 건섬유들이 치밀하게 유지되어 섬유모세포들이 질서 정연하게 배열되어 있는 것이 관찰되었으나, 대조군에서는 건섬유들의 소실과 섬유모세포들의 감소가 관찰되었다. 이러한 변화는 COPD 환자에서 지속되는 만성염증으로 인해 근육 단백질의 저장이 감소하고 근육 단백질 분해가 증가하여 골격근의 감소가 초래되는 병리변화를 반영한다53. 아교음과 가미아교음을 투여한 실험군에서는 건 섬유모세포의 소실과 불규칙한 배열이 감소하는 것이 관찰되어 아교음과 가미아교음 투여가 근손상 증가를 억제할 수 있음이 확인되었다.

결과를 종합하면 아교음과 가미아교음은 COPD 동물모델에서 면역세포들과 염증 cytokine의 활성을 제한하고, 폐조직이 손상되는 것을 줄이는 폐손상 보호효과와 grip strength 및 running time의 감소를 억제하고 근손상을 줄이는 근감소 억제효과를 통해 COPD에 대한 치료 효과를 보일 것으로 생각된다.

Ⅴ. 결 론

COPD에 대한 아교음과 아교음가미의 효과를 평가하기 위해 CSE와 LPS로 유도한 COPD 동물모델에서 폐손상과 연관된 면역세포 및 cytokine과 폐조직의 조직학적 변화와 근력, 근기능 및 근육조직의 조직학적 변화에 대한 영향을 관찰한 대조군과 비교한 결과 다음과 같은 결론을 얻었다.

  1. BALF 내 neutrophil은 아교음 250 mg/kg 투여군 및 아교음가미 250, 500 mg/kg 투여군에서 유의하게 감소하였다.

  2. BALF 내 면역세포 FACS 분석에서 neutrophils, CD4+CD69+ 세포는 아교음가미 125, 250, 500 mg/kg 투여군에서 유의하게 감소하였고, CD4+, CD62L-CD44high+ 세포는 아교음가미 500 mg/kg 투여군에서 유의하게 감소하였으며, Gr-1+SiglecF- 세포는 아교음 250 mg/kg 투여군 및 아교음가미 125, 250, 500 mg/kg 투여군 모두에서 유의하게 감소하였다.

  3. 폐조직의 면역세포 FACS 분석에서 neutrophil, CD62L-CD44high+, CD21+B220+ 세포는 아교음가미 250, 500 mg/kg 투여군에서 유의하게 감소하였고, lymphocyte, CD8+CD69+ 세포는 아교음가미 250 mg/kg 투여군에서 유의하게 감소하였으며, CD4+CD69+ 세포는 아교음 250 mg/kg 투여군과 아교음가미 250, 500 mg/kg 투여군에서 유의하게 감소하였고, Gr-1+SiglecF- 세포는 아교음 250 mg/kg 투여군 및 아교음가미 125, 250, 500 mg/kg 투여군 모두에서 유의하게 감소하였다.

  4. BALF 내 TNF-α는 아교음 250 mg/kg 투여군 및 아교음가미 125, 250, 500 mg/kg 투여군 모두에서 유의하게 감소하였고, IL-17, MIP2, CXCL-1는 아교음 250 mg/kg 투여군 및 아교음가미 250, 500 mg/kg 투여군에서 유의하게 감소하였다.

  5. 폐조직 내 TNF-α, IL-17 mRNA 발현은 아교음 250 mg/kg 투여군에서 유의하게 감소하였고, CXCL-1 mRNA 발현은 아교음 250 mg/kg 투여군 및 아교음가미 125, 250, 500 mg/kg 투여군 모두에서 유의하게 감소하였으며, TRPV1 mRNA 발현은 아교음 250 mg/kg 투여군 및 아교음가미 125 mg/kg 투여군에서 유의하게 감소하였다.

  6. 폐조직 손상에 대한 조직학적 분석 점수는 아교음 250 mg/kg 투여군 및 아교음가미 125, 250, 500 mg/kg 투여군 모두에서 유의하게 감소하였다.

  7. COPD를 유발한 mouse의 grip strength 감소는 아교음 250 mg/kg 투여군 및 아교음가미 125, 250, 500 mg/kg 투여군 모두에서 유의하게 증가하였다.

  8. COPD를 유발한 mouse의 running time 감소는 아교음 250 mg/kg 투여군 및 아교음가미 125, 250, 500 mg/kg 투여군 모두에서 유의하게 증가하였다.

  9. 근손상에 대한 조직학적 분석에서 아교음 250 mg/kg 투여군 및 아교음가미 125, 250, 500 mg/kg 투여군 모두에서 손상을 감소시키는 소견을 나타냈다.

이상으로 COPD 동물모델에서 아교음 및 아교음가미가 면역세포와 염증 cytokine의 조절을 통하여 폐손상을 억제하고 근력 및 근기능의 감소와 근손상을 억제할 가능성을 확인하였다.

감사의 글

이 논문은 2025학년도 대전대학교 교내학술연구비 지원에 의해 연구되었음.

References

1. Viegi G, Pistelli F, Sherrill DL, Maio S, Baldacci S, Carrozzi L. Definition, epidemiology and natural history of COPD. Eur Respir J 2007;30(5):993–1013.
2. Global Intiative for Chronic Obstructive Lung Disease. Global Strategy for the Diagnosis, Management, and Prevention of Chronic Obstructive Pulmonary Disease:2025 Report Available from https://goldcopd.org/2025-gold-report/. (Accessed on 17 Oct 2025).
3. Li H, Liang H, Wei L, Shi D, Su X, Li F, et al. Health Inequality in the Global Burden of Chronic Obstructive Pulmonary Disease:Findings from the Global Burden of Disease Study 2019. Int J Chron Obstruct Pulmon Dis 2022;17:1695–702.
4. GBD 2015 Chronic Respiratory Disease Collaborators. Global, regional, and national deaths, prevalence, disability-adjusted life years, and years lived with disability for chronic obstructive pulmonary disease and asthma, 1990-2015:a systematic analysis for the Global Burden of Disease Study 2015. Lancet Respir Med 2017;5(9):691–706.
5. Chen S, Kuhn M, Prettner K, Yu F, Yang T, Bärnighausen T, et al. The global economic burden of chronic obstructive pulmonary disease for 204 countries and territories in 2020-50:a health-augmented macroeconomic modelling study. Lancet Glob Health 2023;11(8):e1183–e93.
6. Smith MC, Wrobel JP. Epidemiology and clinical impact of major comorbidities in patients with COPD. Int J Chron Obstruct Pulmon Dis 2014;9:871–88.
7. Jaitovich A, Barreiro E. Skeletal muscle dysfunction in chronic obstructive pulmonary disease. What we know and can do for our patients. Am J Respir Crit Care Med 2018;198(2):175–86.
8. Li T, Xu H, Chen L, Xu Y, Zheng Y, Zhao H, et al. The association between skeletal muscle mass and all-cause mortality in acute exacerbation of chronic obstructive pulmonary disease. Front Nutr 2025;12:1568527.
9. Khan MH, Fatima M, Adnan A, Jawaid A, Hassan SM, Talal M, et al. Sarcopenia in chronic obstructive pulmonary disease:mechanisms, diagnosis, and management strategies. Ann Med Surg (Lond) 2025;87(8):5106–21.
10. Lee BJ, Jung HJ, Choi JY, Kang WC, Jung SK. Preliminary study to develop a Korean oriental medical assessment tool for syndrome differentiation of chronic obstructive pulmonary disease. J Korean Oriental Med 2012;33(3):2–94.
11. Lee ES, Han JM, Kim MH, Namgung U, Yeo Y, Park YC. Effects of Inhalable Microparticles of Socheongryong-tang on Chronic Obstructive Pulmonary Disease in a Mouse Model. J Korean Med 2013;34(3):54–68.
12. Yang WK, Lyu YR, Kim SH, Park YC. Effects of GHX02 on Chronic Obstructive Pulmonary Disease Mouse Model. J Korean Med 2018;39(4):126–35.
13. Park JJ, Yang WK, Lyu YR, Kim SH, Park YC. Inhibitory Effects of SGX01 on Lung Injury of COPD Mice Model. J Int Korean Med 2019;40(4):567–81.
14. Kim TH, Yang WK, Lee SW, Kim SH, Lyu YR, Park YC. Inhibitory Effects of GGX on Lung Injury of Chronic Obstructive Lung Disease (COPD) Mice Model. J Korean Med 2021;42(3):56–71.
15. Lee HJ, Kim YE, Kim HJ, Park SJ, Jang YP, Jung SK, et al. Herbal Formula, PM014, Attenuates Lung Inflammation in a Murine Model of Chronic Obstructive Pulmonary Disease. Evid Based Complement Alternat Med 2012;2012(1):769830.
16. Miyamoto A, Asai K, Kadotani H, Maruyama N, Kubo H, Okamoto A, et al. Ninjin'yoeito Ameliorates Skeletal Muscle Complications in COPD Model Mice by Upregulating Peroxisome Proliferator-Activated Receptor γCoactivator-1αExpression. Int J Chron Obstruct Pulmon Dis 2020;15:3063–77.
17. Choi JK, Yang WK, Lee SW, Woo SC, Kim SH, Park YC. Inhibitory Effects of Ssanghwa-tang on Lung Injury and Muscle Loss in a Cigarette Smoke Extract and Lipopolysaccharide-induced Chronic Obstructive Pulmonary Disease Mouse Model. J Int Korean Med 2024;45(1):11–30.
18. Mou Y, Liu Y, Chen Y, Shen R, Yan A, Liao T, et al. Astragalus Polysaccharide Alleviates COPD-Associated Skeletal Muscle Dysfunction Through Suppression of Inflammation and Cellular Senescence. Food Front 2025;6(5):2182–92.
19. 中國哲學書電子化計劃. <聖濟總錄> 卷第65 咳嗽門<聖濟總錄> https://ctext.org/wiki.pl?if=gb&chapter=955016#p58. (Accessed on 20 Oct 2025).
20. Zhang W, Sun S, Fan X, He J, Li Q, Jin H. New approaches to treating chronic obstructive pulmonary disease with Colla corii asini. Animal Model Exp Med 2025;
21. Wang Y, Chen G, Wang Q, Zhou Z, Zhao W, Wong SK, et al. A Comprehensive Review of Traditional Chinese Medicine Ejiao (Colla Corii Asini):Chemical Composition, Quality Control, and Pharmacological Actions. Nat Prod Commun 2025;20(4):1934578X251335424.
22. Kim EH, Rhee DK. Anti-oxidative properties of ginseng. J Ginseng Res 2009;33(1):1–7.
23. Guan S, Liu Q, Han F, Gu W, Song L, Zhang Y, et al. Ginsenoside Rg1 Ameliorates Cigarette Smoke-Induced Airway Fibrosis by Suppressing the TGF-β1/Smad Pathway In Vivo and In Vitro. Biomed Res Int 2017;2017:6510198.
24. Alsayari A, Muhsinah AB, Almaghaslah D, Annadurai S, Wahab S. Pharmacological efficacy of ginseng against respiratory tract infections. Molecules 2021;26(13):4095.
25. Kołtun-Jasion M, Dudek MK, Kiss AK. Eucommiae cortex Comprehensive Phytochemical Analysis Connected with Its In Vitro Anti-Inflammatory Activity in Human Immune Cells. Molecules 2025;30(6):1364.
26. Nowakowska A, Kim M. Deciphering the anti influenza potential of Eucommiae Cortex based on bioinformatics analysis:In silico and in vitro experiments. Exp Ther Med 2025;29(5):106.
27. Mateş L, Banc R, Zaharie FA, Rusu ME, Popa DS. Mechanistic Insights into the Biological Effects and Antioxidant Activity of Walnut (Juglans regia L.). Ellagitannins:A Systematic Review. Antioxidants 2024;13(8):974.
28. Açik M, Çakiroğlu FP. Effects of walnut consumption on inflammatory markers:a review. J Hyg Eng Des 2020;654(577.9):628.3.
29. Park WK, Park SD. Effects of Ssanghwa-tang on the Antifatigue Action and Brain Levels of Norepinephrine, Serotonin, 5-hydroxyindole-acetic acid and Dopamine. Daegu Haany University Jehan Oriental Medical Academy 1995;1(1):130–45.
30. Barnes PJ. Inflammatory mechanisms in patients with chronic obstructive pulmonary disease. J Allergy Clin Immunol 2016;138(1):16–27.
31. Johnson SR. Untangling the protease web in COPD:metalloproteinases in the silent zone. Thorax 2016;71(2):105–06.
32. Hogg JC, McDonough JE, Gosselink JV, Hayashi S. What drives the peripheral lung–remodeling process in chronic obstructive pulmonary disease? Proc Am Thorac Soc 2009;6(8):668–72.
33. Hogg JC, Chu F, Utokaparch S, Woods R, Elliott WM, Buzatu L, et al. The nature of small-airway obstruction in chronic obstructive pulmonary disease. N Engl J Med 2004;350(26):2645–53.
34. Park TS, Yoon SJ, Lee JH, Jang MH, Lee BJ, Kim SH, et al. Respiratory Sarcopenia Research:Current Satus and Future Perspectives. Geriatric Rehabilitation 2024;14(2):79–85.
35. Jones SE, Maddocks M, Kon SS, Canavan JL, Nolan CM, Clark AL, et al. Sarcopenia in COPD:prevalence, clinical correlates and response to pulmonary rehabilitation. Thorax 2015;70(3):213–18.
36. Kim HC, Lee GD, Hwang YS. Skeletal Muscle Dysfunction in Patients with Chronic Obstructive Pulmonary Disease. Tuberc Respir Dis 2010;68(3):125–39.
37. Yum JY, Suh ES, Kwon J, Jeon H, So JN, Eun JS. Effects of Samultang on immune function during the late stage of pregnancy in Balb/c mice. Kor J Pharmacogn 2000;31(2):142–48.
38. Lee SY, Lee H, Go EJ, Park YC, Choi SK, Yu CY, et al. Effect of Astragalus membranaceus polysaccharides on improves immune response after exhaustive exercise rats. Korean J Medicinal Crop Sci 2018;26(1):1–7.
39. Smyth LJ, Starkey C, Vestbo J, Singh D. CD4-regulatory cells in COPD patients. Chest 2007;132(1):156–63.
40. Qin K, Xu B, Pang M, Wang H, Yu B. The functions of CD4 T-helper lymphocytes in chronic obstructive pulmonary disease. Acta Biochim Biophys Sin (Shanghai) 2022;54(2):173–78.
41. Lokwani R, Wark PA, Baines KJ, Fricker M, Barker D, Simpson JL. Blood neutrophils in COPD but not asthma exhibit a primed phenotype with downregulated CD62L expression. Int J Chron Obstruct Pulmon Dis 2019:2517–25.
42. DeGrendele HC, Estess P, Siegelman MH. Requirement for CD44 in activated T cell extravasation into an inflammatory site. Science 1997;278(5338):672–75.
43. Hong JH, Kang MH, Lee JJ, Cha MS, Bae YS, Kim HY, et al. γδ+T-cell-derived IL-17A stimulates airway epithelial/stromal cells to secrete G-CSF, promoting lung-specific pathogenic Siglec-F+neutrophil development in PPE-induced emphysema. Cell Mol Immunol 2025;22:791–805.
44. Aaron SD, Angel JB, Lunau M, Wright K, Fex C, LE SAUX N, et al. Granulocyte inflammatory markers and airway infection during acute exacerbation of chronic obstructive pulmonary disease. Am J Respir Crit Care Med 2001;163(2):349–55.
45. Deveci Y, Deveci F, Ilhan N, Karaca I, Turgut T, Muz MH. Serum ghrelin, IL-6 and TNF-αlevels in patients with chronic obstructive pulmonary disease. Tuberk Toraks 2010;58(2):162–72.
46. Traves SL, Donnelly LE. Th17 cells in airway diseases. Curr Mol Med 2008;8(5):416–26.
47. Levänen B, Glader P, Dahlen B, Billing B, Qvarfordt I, Palmberg L, et al. Impact of tobacco smoking on cytokine signaling via interleukin-17A in the peripheral airways. Int J Chron Obstruct Pulmon Dis 2016:2109–16.
48. Henrot P, Prevel R, Berger P, Dupin I. Chemokines in COPD:from implication to therapeutic use. Int J Mol Sci 2019;20(11):2785.
49. Chung KF, Pavord ID. Prevalence, pathogenesis, and causes of chronic cough. Lancet 2008;371(9621):1364–74.
50. Baraldo S, Turato G, Saetta M. Pathophysiology of the small airways in chronic obstructive pulmonary disease. Respiration 2012;84(2):89–97.
51. Maltais F, Decramer M, Casaburi R, Barreiro E, Burelle Y, Debigare R, et al. An official American Thoracic Society/European Respiratory Society statement:update on limb muscle dysfunction in chronic obstructive pulmonary disease. Am J Respir Crit Care Med 2014;189(9):e15–e62.
52. Ma K, Huang F, Qiao R, Miao L. Pathogenesis of sarcopenia in chronic obstructive pulmonary disease. Front Physiol 2022;13:850964.
53. Byun MK, Cho EN, Chang J, Ahn CM, Kim HJ. Sarcopenia correlates with systemic inflammation in COPD. Int J Chron Obstruct Pulmon Dis 2017;12:669–75.

Article information Continued

Table 1

The Composition of Agyo-eum (AGE) and modified Agyo-eum (mAGE)

Herb Pharmacognostic name Amount (g)
Agyo Asini Gelatinum 4.0
Insam Ginseng Radix 8.0

Total amount 12.0

Fig. 1

Time schedule of experimental design for CSE+LPS exposure mouse model.

CSE+LPS : intranasal injection of cigarette smoke extract 1 mg/ml and LPS 100 μg/ml.

Table 2

The Composition of modified Agyo-eum (mAGE)

Herb Pharmacognostic name Amount (g)
Agyo Asini Gelatinum 2.0
Insam Ginseng Radix 4.0
Hodoyuk Juglandis Semen 2.0
Duchung Eucommiae Cortex 4.0

Total amount 12.0

Table 3

Oligonucleotide Sequence Used for Real-time PCR

Gene Primer Sequence
TNF-α Forward 5’- TCTGGTTCAAACACTCAGGTCC-3’

Reverse 5’- AGGGCATTGGCATACGAGTC-3’

IL-17 Forward 5’-TCTCCACCGCAATGAAGACC-3’

Reverse 5’-ACCGTTCCACATGCTGCTG-3’

MIP2 Forward 5’-GCTGGCCACCAACCACCAG-3’

Reverse 5’-AGCGAGGCACATCAGGTACG-3’

TRPV1 Forward 5’-CACTGTGTTCTTCAGCCTGGT-3’

Reverse 5’-GATGTTCTTGCAGGAGGATGA-3’

G3PDH VIC TGGCAAAGTGGAGATTGTTGCCATCA

Fig. 2

Effect of AGE and mAGE on (A) cytospin image of neutrophils and (B) absolute number of neutrophils in BALF of COPD mice.

Mice were injected intranasally with CSE+LPS (Control), and then treated with Dexa (dexamethasone 3 mg/kg) and SHT (250, 500 mg/kg) for 28 days (n=4). All values are mean±standard error. † : Significantly different from the Normal (††† p<0.001), * : Significantly different from the Control (** p<0.01, *** p<0.001).

Table 4

Absolute Number of Various Immune Cells in BALF of COPD Mouse Model treated by AGE and mAGE

Cell subtypes in BALF Normal Control Dexa AGE250 mAGE125 mAGE250 mAGE500
Lymphocyte (×105 cells) 2.95±1.15 26.90±9.27 12.51±0.54 17.21±3.41 13.56±2.51 12.31±8.70 8.70±1.36
Neutrophils (×105 cells) 8.01±3.21 24.00±6.47 13.47±1.38 12.58±1.13 8.80±2.67* 7.00±1.47** 5.78±0.32**
Eosinophils (×105 cells) 21.80±11.07 42.15±9.97 23.85±0.81 46.13±6.53 29.93±5.91 27.38±7.10 23.47±1.58
CD4+ (×105 cells) 3.65±2.05 35.82±11.75†† 17.50±0.83 23.24±6.00 14.24±2.16 14.25±4.32 10.71±1.32*
CD8+ (×105 cells) 1.01±0.74 14.30±2.24††† 10.22±1.39 9.76±2.09 9.81±1.59 8.37±2.69 9.18±1.23
CD4+CD69+ (×105 cells) 2.13±0.57 25.03±6.06†† 6.79±0.27** 15.54±4.37 9.48±1.78** 8.96±2.90* 6.24±0.76**
CD8+CD69+ (×105 cells) 0.18±0.16 5.72±2.89 1.41±0.14 1.67±0.39 2.19±0.56 1.27±0.37 1.09±0.23
CD62L-/CD44high+ (×105 cells) 4.68±1.68 66.60±18.09†† 31.84±1.06 48.07±7.68 33.39±7.73 29.11±7.26 19.52±1.11**
Gr-1+SiglecF-(×105 cells) 2.07±1.27 7.51±1.65†† 2.98±0.90* 2.01±0.72** 1.69±0.40** 0.79±0.23*** 0.71±0.17***

Mice were injected intranasally with CSE+LPS (Control), and treated with dexamethasone 3 mg/kg (Dexa), AGE (250 mg/kg) and mAGE (125, 250, 500 mg/kg). Data are presented as mean±standard error (n=8). † : Significant difference compared with the Normal ( p<0.05, †† p<0.01, ††† p<0.001), * : Significant difference compared with Control (* p<0.05, ** p<0.01, *** p<0.001).

Table 5

Absolute Number of Various Immune Cells in Lung of COPD Mouse Model treated by AGE and mAGE

Cell subtypes in BALF Normal Control Dexa AGE250 mAGE125 mAGE250 mAGE500
Lymphocyte (×105 cells) 12.17±1.22 42.92±11.74†† 13.18±1.98** 34.03±2.09 37.61±15.20 17.20±5.08* 24.48±2.55
Neutrophils (×105 cells) 7.12±1.19 31.04±8.93†† 15.09±1.71 16.24±1.81 18.22±6.78 8.55±1.49** 8.71±2.83*
Eosinophils (×105 cells) 4.99±0.90 44.14±12.60†† 14.78±3.28* 39.14±7.45 48.50±12.68 26.39±4.86 25.72±7.73
CD4+ (×105 cells) 10.41±1.14 39.80±9.00†† 14.60±2.30** 33.78±4.31 37.06±14.73 23.25±7.05 21.61±4.54
CD8+ (×105 cells) 4.02±0.41 25.21±7.51†† 8.68±1.02* 16.54±1.58 17.46±5.31 6.05±0.92** 13.11±2.85
CD4+CD69+ (×105 cells) 0.59±0.11 12.28±1.54††† 1.75±0.33*** 7.14±0.92** 11.17±5.83 5.37±1.37** 4.90±1.64**
CD8+CD69+ (×105 cells) 0.44±0.20 3.60±1.38 0.78±0.12* 1.86±0.23 2.67±0.83 0.81±0.16* 1.76±0.68
CD62L-/CD44high+ (×105 cells) 3.23±0.49 47.62±10.58††† 12.29±3.54** 33.32±4.40 35.30±11.25 19.49±3.71** 18.58±6.51*
CD21+B220+ (x105 cells) 0.69±0.13 5.14±1.18†† 1.25±0.18** 2.40±0.74 3.22±0.86 1.52±0.43** 1.45±0.14**
Gr-1+SiglecF-(×105 cells) 3.41±0.69 14.00±3.48†† 1.61±0.06** 3.19±0.38** 2.03±0.93** 1.45±0.31** 0.78±0.18**

Mice were injected intranasally with CSE+LPS (Control), and treated with dexamethasone 3 mg/kg (Dexa), AGE (250 mg/kg) and mAGE (125, 250, 500 mg/kg). Data are presented as mean±standard error (n=8). † : Significant difference compared with the Normal ( p<0.05, †† p<0.01, ††† p<0.001), *: Significant difference compared with Control (* p<0.05, ** p<0.01, *** p<0.001).

Fig. 3

Effect of AGE and mAGE on TNF-α production in BALF of COPD mice.

Mice were injected intranasally with CSE+LPS (Control), and then treated with Dexa (dexamethasone 3 mg/kg), AGE250 (250 mg/kg) and mAGE125 (125, 250, 500 mg/kg) for 28 days (n=4). Level of TNF-α was determined using ELISA. All values are mean±standard error. † : Significantly different from the Normal (††† p<0.001), * : Significantly different from the Control (*** p<0.05), ** : Significantly different from the Control (*** p<0.01). *** : Significantly different from the Control (*** p<0.001).

Fig. 4

Effect of AGE and mAGE on IL-17 production in BALF of COPD mice.

Mice were injected intranasally with CSE+LPS (Control), and then treated with Dexa (dexamethasone 3 mg/kg), AGE250 (250 mg/kg) and mAGE125 (125, 250, 500 mg/kg) for 28 days (n=4). Level of IL-17 was determined using ELISA. All values are mean±standard error. † : Significantly different from the Normal (††† p<0.001), * : Significantly different from the Control (** p<0.05, ** p<0.01, *** p<0.001).

Fig. 5

Effect of AGE and mAGE on MIP2 production in BALF of COPD mice.

Mice were injected intranasally with CSE+LPS (Control), and then treated with Dexa (dexamethasone 3 mg/kg), AGE250 (250 mg/kg) and mAGE125 (125, 250, 500 mg/kg) for 28 days (n=4). Level of MIP2 was determined using ELISA. All values are mean±standard error. † : Significantly different from the Normal (††† p<0.001), * : Significantly different from the Control (* p<0.05, ** p<0.01, *** p<0.001).

Fig. 6

Effect of AGE and mAGE on CXCL-1 production in BALF of COPD mice.

Mice were injected intranasally with CSE+LPS (Control), and then treated with Dexa (dexamethasone 3 mg/kg), AGE250 (250 mg/kg) and mAGE125 (125, 250, 500 mg/kg) for 28 days (n=4). Level of CXCL-1 was determined using ELISA. All values are mean±standard error. † : Significantly different from the Normal (††† p<0.001), * : Significantly different from the Control (* p<0.05, ** p<0.01, *** p<0.001).

Fig. 7

Effect of AGE and mAGE on TNF-α mRNA expression in lung tissue of COPD mice.

Mice were injected intranasally with CSE+LPS (Control), and then treated with Dexa (dexamethasone 3 mg/kg), AGE250 (250 mg/kg) and mAGE125 (125, 250, 500 mg/kg) for 28 days (n=4). All values are mean±standard error. † : Significantly different from the Normal (††† p<0.001), * : Significantly different from the Control (* p<0.05, ** p<0.01, *** p<0.001).

Fig. 8

Effect of AGE and mAGE on IL-17 mRNA expression in lung tissue of COPD mice.

Mice were injected intranasally with CSE+LPS (Control), and then treated with Dexa (dexamethasone 3 mg/kg), AGE250 (250 mg/kg) and mAGE125 (125, 250, 500 mg/kg) for 28 days (n=4). All values are mean±standard error. † : Significantly different from the Normal (††† p<0.001), * : Significantly different from the Control (* p<0.05, ** p<0.01, *** p<0.001).

Fig. 9

Effect of AGE and mAGE on CXCL-1 mRNA expression in lung tissue of COPD mice.

Mice were injected intranasally with CSE+LPS (Control), and then treated with Dexa (dexamethasone 3 mg/kg), AGE250 (250 mg/kg) and mAGE125 (125, 250, 500 mg/kg) for 28 days (n=4). All values are mean±standard error. † : Significantly different from the Normal (††† p<0.001), * : Significantly different from the Control (* p<0.05, ** p<0.01, *** p<0.001).

Fig. 10

Effect of AGE and mAGE on TRPV1 mRNA expression in lung tissue of COPD mice.

Mice were injected intranasally with CSE+LPS (Control), and then treated with Dexa (dexamethasone 3 mg/kg), AGE250 (250 mg/kg) and mAGE125 (125, 250, 500 mg/kg) for 28 days (n=4). All values are mean±standard error. † : Significantly different from the Normal (††† p<0.001), * : Significantly different from the Control (* p<0.05, ** p<0.01, *** p<0.001).

Fig. 11

Effect of AGE and mAGE on histophathological changes in the lung of CSE+LPS-induced COPD mice.

Mice were injected intranasally with CSE+LPS (Control), and then treated with Dexa (dexamethasone 3 mg/kg), AGE250 (250 mg/kg) and mAGE125 (125, 250, 500 mg/kg) for 28 days (n=4). A) Representative sections of lung stained with H&E stain and M-T stain. Image from light microscope at 100× magnification. (B) Quantitative evaluation of the degree of lung tissue damage in the sections. All values are mean±standard error. †: Significantly different from the Normal (††† p<0.001), * : Significantly different from the Control (* p<0.05, ** p<0.01, *** p<0.001).

Fig. 12

Effect of AGE and mAGE on grip strength of COPD mice.

Mice were injected intranasally with CSE+LPS (Control), and then treated with Dexa (dexamethasone 3 mg/kg), AGE250 (250 mg/kg) and mAGE125 (125, 250, 500 mg/kg) for 28 days (n=4). Grip force was determined using grip strength meter. All values are mean±standard error. † : Significantly different from the Normal (††† p<0.001), * : Significantly different from the Control (* p<0.05, ** p<0.01, *** p<0.001).

Fig. 13

Effect of AGE and mAGE on running time of COPD mice.

Mice were injected intranasally with CSE+LPS (Control), and then treated with Dexa (dexamethasone 3 mg/kg), AGE250 (250 mg/kg) and mAGE125 (125, 250, 500 mg/kg) for 28 days (n=4). Grip force was determined using grip strength meter. All values are mean±standard error. † : Significantly different from the Normal (††† p<0.001), * : Significantly different from the Control (* p<0.05, ** p<0.01, *** p<0.001).

Fig. 14

Effect of AGE and mAGE on histophathological changes in the quadriceps muscle of CSE+LPS-induced COPD mice model.

Mice were injected intranasally with CSE+LPS (Control), and then treated with Dexa (dexamethasone 3 mg/kg), AGE250 (250 mg/kg) and mAGE125 (125, 250, 500 mg/kg) for 28 days (n=4). Grip force was determined using grip strength meter. All values are mean±standard error. Representative sections of quadriceps muscle stained with H&E stain and M-T stain. Image from light microscope at 100× magnification.